1. In relation to genetic variation characteristics of Influenza virus
a) Describe the difficulties this poses for public protection by vaccination (50%)
b) Explain using examples, how the altered pathogenesis of newly emerging strains impactsh uman disease (50%)
3. Using specific examples,
a) Explain how essential biochemical processes in the bacterial cell are inhibited ord isrupted by antibiotics. (80 %)
b) Discuss what makes an appropriate molecular target for an antibiotic as an anti-infective drug. (20%
Category: Biology
Pls answe any 2 questions from these.
Section B: Immunology
Answer two questions from this section.
4. Compare and contrast the response of dendritic cells and macrophages to danger signals.
5. Compare and contrast the activation of B and T cells.
6. Compare and contrast the function of B cell antibody classes and T cell subtypes.
Ethical considerations for germline genome editing. Describe a potential “slippery slope” scenario as an argument against germline genome editing.
At which point, if any, does this argument fail?
Part I:
Review the picture attached which shows actual pictures of red blood cells exposed to a variety of osmotic solutions.
Red Blood Cells
Solution A Solution B Solution C
Answer the following questions:
1. Using the terms isotonic, hypertonic or hypotonic, identify what type of solution into which each group of red cells has been placed.
2 . For each of the solutions, identify a percent salt solution that would have caused the results that you saw picture. Hint: Most cellular fluids are composed mainly of water and salts. You will need to know the normal percent salt solution in red blood cells in order to determine the answer to this question.
3. What visual difference(s) did you observe in the changes between the three cells in each of the solutions. Pick one of those differences and research their impact on a specific example in biological systems and provide a report on the impact. When you consider “impact”, consider both positive and negative impact.
Part II:
The data in the table attached shows the results of an experiment investigating plant growth when exposed to different colors of the light spectrum.
1. What conclusions can be drawn from this data? Explain in detail and provide source citations.
2. Was a control used in this experiment? If so, what was it? If not, what would be an appropriate control for this experiment? Explain your answer.
3. Do the graphs reproduced below support the data in the table? Explain why or why not.
Week 4
In addition to being essential within living organisms, enzymes are also used in many of the products we use! Check your cleaning supplies at home, do any of them list enzymes on the ingredient list? If so, does it say which type of enzyme? Do any of the other products you use contain enzymes? What type of enzymes are used in industry? Which enzymes are found in the food we eat?
Personal Response: You must post a personal response to the discussion. After doing some research, choose and describe one enzyme that is used in cleaning products, other products, industrial procedures or that is found in food. Explain how this enzyme is used. What is the substrate in the enzyme-facilitated chemical reaction? And what is the product(s) in the enzyme-facilitated chemical reaction? Remember that a chemical reaction converts one or more substrates to one or more products, and that most enzymes are substrate specific. When looking for enzymes remember that their names end with -ase! Your personal response must be a minimum of 150 words (more is OK) and must address each of the components stated in the prompt. If any sources for are consulted for the preparation of the personal response or if any material is quoted or referenced in the response, citations (in APA format) for the sources must be included at the end of the personal response.
——————————————————————————————————————————————————————
Week 5
The year 2017 marked the 40th anniversary of DNA sequencing technology (https://www.nature.com/articles/nature24286). DNA sequencing has helped us solve crimes, identify and treat diseases, and understand the relationships between organisms and groups of organisms in ways that would have been unimaginable a generation ago.
Personal Response: You must post a personal response to the discussion. For this discussion, please find and summarize a specific example of the use DNA sequencing technology to solve a case, or problem, or to advance our understanding of a specific issue. The key here is SPECIFIC! Please don’t post a response in which you discuss this in general terms. Find and discuss a SPECIFIC example. Your personal response must be a minimum of 150 words (more is OK) and must address all of the components stated in the prompt. If any sources are consulted for the preparation of the personal response or if any material is quoted or referenced in the response, citations (in APA format) for the sources must be included at the end of the personal response.
Is this a beneficial molecule to consume?
Week 2 Classmate Responses
You must comment on two classmate’s personal response to the discussion. Your comment on a classmate’s personal response to the discussion must be a substantive comment that contributes to their learning. The comment must be a minimum of 100 words. Both classmates initial post is in the attachments.
Below is in reference to this weeks discussion for your reference.
You must post a personal response to the discussion. Pick a type of food that you enjoy. Before you start researching, state a hypothesis about the nutritional content of this food. Remember that a hypothesis is a tentative explanation of an observation (and it may be wrong), and a good hypothesis is specific. Then summarize what you learned from your research. Include an image of at least one molecule found in this food and briefly describe that molecule in terms of the atoms it is made of and potentially the chemical bonds that keep the atoms together. Is this a beneficial molecule to consume? Explain why. Did your research support your hypothesis?
Topic: Glycoproteins, glycosylation & Cancer
This
week you learned about carbohydrates and the importance of glycolipids,
glycoproteins, and glycosylation for the functional interaction between
the different components found in the extracellular matrix (ECM). You
further heard about the importance of the proper sequence of the
carbohydrates on glycoproteins (the “sugar code”) and the key role of
sialic acid in many important cellular processes, ranging from cell-cell
interaction, immune function, and cancer. You heard that the
extracellular carbohydrate coat of cells, called glycocalyx, plays a
role in tumor formation and metastasis. As you work on this assignment,
consider that approximately half of all human proteins known to date are
glycosylated and the majority of cancer biomarkers are comprised of
glycoproteins. About 270,000 new cases of breast cancer are diagnosed in
the U.S. per year and 6.9% of all cancer-related deaths will result
from breast cancer. Also consider that the human receptor
tyrosine-protein kinase erbB-2 (HER2), one of the proteins found mutated
in many breast cancer patients, has multiple sites of N-glycosylation
important for its biological function.
This week I want you to do some literature research, preferably on PubMed (www.ncbi.nlm.nih.gov/pubmed)
or MedLine) on the role of glycosylation and the “sugar code” in cancer
development and/or progression. If you cannot find anything appealing
to you, you may use the already posted scientific review article:
Scott
D.A. & Drake R.R. Glycosylation and its implication in breast
cancer. Exp. Rev. Proteomics. 2019 Aug.; 16(8): 665-680 as reading
material for your post. Then engage in a discussion with your classmates
over the next two days after your initial posting.
Your initial post should address 3 or 4 of the following aspects:
Scientific evidence showing a role of glycosylation in tumor development and/or metastasis?
Which enzymes important for glycosylation are known/mentioned to play a role in tumorigenesis and cancer?
Which sugar residues and “glyco-antigens” are discussed to play a role in tumorigenesis and cancer?
Do
the cells of different cancers express different glycosylation
patterns? If so, what is discussed by the scientist(s) to be
responsible?
What are the diagnostic methods used to detect alterations in glycosylation patterns amongst normal cells and tumor cells?
Where are or what are the challenges in the field of glyco-biology?
Be sure to include your reference at the end of your initial posting to receive full credit.
Read the Instruction Word Document fully and you are provided two pdf example papers I made, and I want you to look over as well. Do not use these for your chosen topic but do take inspiration in how I tackled mine and how I structured it. I would like you to structure the work you will be making similar to how I did it.
Please watch both video links and write 3 paragraphs on what you learned. – Please use APA references at least 2.
Your assigned reading over the past two weeks has introduced you to the structure and function of DNA.
Write a brief outline of the mechanisms in which DNA is used to generate protein. You do not need to provide a fine level of detail, but ensure you reflect on the key points in the process and mention any major differences between the mechanism in prokaryotic and eukaryotic cells
Although the DNA in our genes is considered to be the heritable genetic material, other factors, including the environment are considered to play an important role in the activity and expression of those genes. Summarize the role that epigenetics & developmental epigenetics play in health & disease.
Finally – using the codon table found in Figure 15.4 in Chapter 15 of the textbook, translate these two almost identical RNA strands into peptide sequences, using the first base of each as the first triplet in a codon. You will notice that the second strand has a point deletion (the u in bold) with respect to the first strand – comment on how this has affected the resulting peptide chain.
aguuguuaucgaaaacugcgaguaaauauccugagggcgcgaagcaacc
aguuguaucgaaaacugcgaguaaauauccugagggcgcgaagcaaccYour assigned reading over the past two weeks has introduced you to the structure and function of DNA.
Write a brief outline of the mechanisms in which DNA is used to generate protein. You do not need to provide a fine level of detail, but ensure you reflect on the key points in the process and mention any major differences between the mechanism in prokaryotic and eukaryotic cells
Although the DNA in our genes is considered to be the heritable genetic material, other factors, including the environment are considered to play an important role in the activity and expression of those genes. Summarize the role that epigenetics & developmental epigenetics play in health & disease.
Finally – using the codon table found in Figure 15.4 in Chapter 15 of the textbook, translate these two almost identical RNA strands into peptide sequences, using the first base of each as the first triplet in a codon. You will notice that the second strand has a point deletion (the u in bold) with respect to the first strand – comment on how this has affected the resulting peptide chain.
aguuguuaucgaaaacugcgaguaaauauccugagggcgcgaagcaacc
aguuguaucgaaaacugcgaguaaauauccugagggcgcgaagcaacc